snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA74
sequence
CCCAGCGGTAGTCAGCTGTGCAGGCCAGACCATGCCTGAGCTAGTGTTACTCTGCTGGA
AGAGAAAGGCACTGCCATTTGTGCTCCATCAGGTTTGGCTGTTTTAGTGAATCCTGCTGT
GTGGTGCTGGTTATGCCATGTCTTCTGAGAGTGGCCTGTACTCACAAAATGAGGCAGGCC
TAGTCTGGAGGCAAACACT
  Box motif
  Complementary to target RNA
length 198
organism Danio_rerio
snoRNA name SNORA74
alias
chromosome ⁄ contig 14
locus ⁄ host gene si:dkey-102m7.3
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007125.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved