snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA13
sequence
AGCCTTTATGTGTTGCCTGTTCATTTCCTTTTCAGAATGAACATGGTGTCAGAAAAGGC
GCACATTAACTCTTATTGTGATCTTAAATGGTTGTCAAAGTACTTCCGTTAAATAAGCTC
AACAATAAGAACATGA
  Box motif
  Complementary to target RNA
length 135
organism Danio_rerio
snoRNA name SNORA13
alias
chromosome ⁄ contig 13.0
locus ⁄ host gene ldb1a
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no NC_007124.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved