snOPY snoRNA Orthological Gene Database
Danio_rerio snR50
sequence
GAATATGAAAAAGAAGCAGCAAAGATATAAGAGAACTTTTATGTTTGAATCAAACAACA
TAACGATTACAGGCAAATCAGCAGTGTTATC
  Box motif
  Complementary to target RNA
length 90
organism Danio_rerio
snoRNA name snR50
alias
chromosome ⁄ contig 12.0
locus ⁄ host gene Mono:34:snR50
organization Mono
target RNA Unknown
modification type H/ACA
modification site
accession no NC_007123.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved