snOPY snoRNA Orthological Gene Database
Danio_rerio snoU6-53
sequence
TTCCAATGATGAGCCTGCCATGCTAATACTGATGCACCAGAGTTTGACTGTGTCTCACA
CTGGGTGTAAGTGTGTTCAACTAAACTTCTCACACTTGCAGTGTGCTCTGAGGAAA
  Box motif
  Complementary to target RNA
length 115
organism Danio_rerio
snoRNA name snoU6-53
alias
chromosome ⁄ contig 7.0
locus ⁄ host gene acin1b
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site
accession no NC_007118.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved