snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA32
sequence
TGGTCATTTACCAAGGCATTTGGGATGCATTGTTCCTGACTTGCTATGGACGTGACCAA
AAATTAAAACCCATCCTAATGAGTCACTTCAGTTTCAATGCTGTTGGGGTTTCTTAGGAA
CAGTC
  Box motif
  Complementary to target RNA
length 124
organism Danio_rerio
snoRNA name SNORA32
alias
chromosome ⁄ contig 5.0
locus ⁄ host gene si:ch211-209a2.1
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007116.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved