snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD63
sequence
CATTCTGATCAACACATCATTCTGAAGGATTTTAAATGTTTAGAATTAGTGTTTGA
  Box motif
  Complementary to target RNA
length 56
organism Danio_rerio
snoRNA name SNORD63
alias
chromosome ⁄ contig 5.0
locus ⁄ host gene Mono:26:SNORD63
organization Mono
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007116.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved