snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA68
sequence
TCTGCACACAAACCCAAAGGTCATCTCTCCATCATGTCTTGCCCTTGCTATGTGTGCGC
AAAGAAAAAGGAACCTTGTCGCCTTTCATGGGCTGTGTGTTGACGTGCCTCTGAAAGTGA
ATTCAAGGAGCCACATCT
  Box motif
  Complementary to target RNA
length 137
organism Danio_rerio
snoRNA name SNORA68
alias
chromosome ⁄ contig 4.0
locus ⁄ host gene rpl18a
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007115.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved