snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA62
sequence
GTTGCACACAGTTAGAGCCCTGCGCTGCTGGCGGTGCATTGTGGGGTGTAGGATGTGTG
CTAAAACACTGCAGGGTCTCTGATCTCTTCTTTCTGTTCTTCATGAGAGCTGAGAAAATG
AAGATCCTGCCACAAAT
  Box motif
  Complementary to target RNA
length 136
organism Danio_rerio
snoRNA name SNORA62
alias
chromosome ⁄ contig 3.0
locus ⁄ host gene Mono:5:SNORA62
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007114.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved