snOPY snoRNA Orthological Gene Database
Danio_rerio snoU83B
sequence
CGTGCATGTAATGATGAAAAACATGGATTAACCGCGTCAGGCATGGCGCCCGAAACGCA
TGAGGAAATTTCCCATGCTGCCTTCCTTCTGACAGCACA
  Box motif
  Complementary to target RNA
length 98
organism Danio_rerio
snoRNA name snoU83B
alias
chromosome ⁄ contig 3.0
locus ⁄ host gene rpl3
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NC_007114.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved