snOPY snoRNA Orthological Gene Database
Danio_rerio snoU85
sequence
GCCCAATGATGAGACCAAGGCGAATGCGAGCCCACTGAATTAGAGTCTGAGCTCTCCTG
TGCTTCTATTGGCTGGTAATCTTGGCTGGACTGCGAAGGTTTGCTGTCTTGCTGTAAGGG
CCTGCCTATATTGAACAAGCCCTTTCCTTCGAAATTTCCTTTTAAAGAGATGGGGGAAGT
GTAAAGGTGAGGGGCATACATTTTATTTGTGTGTGTGTGTGTGTGTGTGTGATCAGGATC
ACAGGTTGAGTCTTGGTTTTCTGTAGTAATTCTGTAGGCATTGAGCTCTGTCTTTGGTAA
TCTGAGGGCA
  Box motif
  Complementary to target RNA
length 309
organism Danio_rerio
snoRNA name snoU85
alias
chromosome ⁄ contig 2.0
locus ⁄ host gene ncapd2
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NC_007113.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved