snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD60
sequence
AGCCGCTGATGACTTCAGTTTACTTTTTCTGACACCTCGTATGAACGCTGTAATTCAGC
AACTGATTATTAAGTTTAGTCTGAGGCTC
  Box motif
  Complementary to target RNA
length 88
organism Danio_rerio
snoRNA name SNORD60
alias
chromosome ⁄ contig 1.0
locus ⁄ host gene wu:fc47e11
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007112.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved