snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA84
sequence
GCCTTGTGGTTCCTTAAGACAGCTCATCGGTGCTGATGCTTGAGGTTGTGTTTGACGGG
CACACATTGATCTCTGCAATTTAATGCGTGGTGGCTGACATTTCCATGCAGCTTCCACAG
CCCGGTTGCAGAAACATGT
  Box motif
  Complementary to target RNA
length 138
organism Danio_rerio
snoRNA name SNORA84
alias
chromosome ⁄ contig 1
locus ⁄ host gene kpnb3
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NC_007112.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved