snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA70
sequence
CTGCAGCTTATTAAGCCGACTGGACAGGTTGTGTGTACTTGTGTGGTGTGCAAAGGCTG
CAGACAGTAAATCTTTGGTTGTGTATGAGCCTAGCTGGGTAGTGCTGGGCCCTTTAAGGG
ACCATTGAAACATGC
  Box motif
  Complementary to target RNA
length 134
organism Danio_rerio
snoRNA name SNORA70
alias
chromosome ⁄ contig 23
locus ⁄ host gene RPL10
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no NC_007134.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved