snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD100
sequence
TGTATCTGTGATGATAATTTGGCTCCCTCTACTGAAGTCTCTGAGGAAAACTGCCATTC
GTTACCCAATTTCTTACTGAGATACT
  Box motif
  Complementary to target RNA
length 85
organism Danio_rerio
snoRNA name SNORD100
alias
chromosome ⁄ contig 23
locus ⁄ host gene rps12
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no NC_007134.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved