snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA2
sequence
GTAGCCCTGAATCAAGGCCCGCAGCTTGCTGTAGCTGTTGGTTTCAAACAGCGGCTGAC
ACAAAACACTTCTTAAGGTCTGTTGACTTTCCCAAAATGATCTGATGGGTTAAGTCGATT
TCATTTTGAAGGAACATTT
  Box motif
  Complementary to target RNA
length 138
organism Danio_rerio
snoRNA name SNORA2
alias
chromosome ⁄ contig 23.0
locus ⁄ host gene zgc:103534
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007134.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved