snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA75
sequence
CGCTTCTCATGAGCTCCTCTCCGTCAGTCCAGTGGCGGTGTATGGATTCGCACGAGAAG
TAGAGTCAAAATCACAGTTAATCAGGTGTTCTCAGTGTTGCACCGATGTCTGATGTGAGA
CACTT
  Box motif
  Complementary to target RNA
length 124
organism Danio_rerio
snoRNA name SNORA75
alias
chromosome ⁄ contig 22.0
locus ⁄ host gene zgc:152810
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no NC_007133.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved