snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD83
sequence
GCCACATGATGTGATGTAGATTGCATTAGCACACTGTGCAGAGATGACCAGTTATCTAT
CACCCATGACTGATGGCT
  Box motif
  Complementary to target RNA
length 77
organism Danio_rerio
snoRNA name SNORD83
alias
chromosome ⁄ contig 21.0
locus ⁄ host gene zgc:110395
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NC_007132.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved