snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD94
sequence
GGAGCAATGATGAGTGGCGCAGGGGTACGTACCTCAGCTGATAATGGGAGCTGAGTGTT
GACTGCTCAAAATCAGTGGACATGTGGTCAGCTGGTTGTAGGGTGTCAGCACGAAATTAT
CGCCTTGACTGAGCTCC
  Box motif
  Complementary to target RNA
length 136
organism Danio_rerio
snoRNA name SNORD94
alias
chromosome ⁄ contig 19.0
locus ⁄ host gene rrm2
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site
accession no NC_007130.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved