snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA73
sequence
CCAACGTGGACATCCCGTGAGATGCCTCTCATGTGGCTCTGTCCATGTGGCGTATGGGA
GCGTAGCACTTCGGTGTTGTGACGTACAGTCCCGTTCCACGACGTTGGATAGCAAGCTTG
TCCCCGGCCTCTGGCTGGTGTGGACTACGTCCTGTATATTCCTACATCTTCCCAGAGCCC
TTTGGGCCATTACTGGGGAGGTAAACCATGCAGTGCACACTA
  Box motif
  Complementary to target RNA
length 221
organism Danio_rerio
snoRNA name SNORA73
alias
chromosome ⁄ contig 20.0
locus ⁄ host gene rps7
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NC_007131.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved