snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD111
sequence
TAATGAAATGATGAGCTTTTCATGTCTCTTCTCTGACTATTTGACTGGAGACGCATAAA
GACCTCTGATCATAATA
  Box motif
  Complementary to target RNA
length 76
organism Danio_rerio
snoRNA name SNORD111
alias
chromosome ⁄ contig 18
locus ⁄ host gene sf3b3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007129.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved