snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD74
sequence
TGTTTACTTGTATGATGAAGAATATGTTGGTAGGGACATCTGAGAAAATCTGATGAATG
CCAACATTTCTGACATGTAGCA
  Box motif
  Complementary to target RNA
length 81
organism Danio_rerio
snoRNA name SNORD74
alias
chromosome ⁄ contig 8.0
locus ⁄ host gene gas5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007119.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved