snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA30
sequence
TAAGCACTTTTAACAGGTCGTGGTCTCAGTGCAGTAGGCCATGATTTGGTAGCTGGTGC
TGATATGAAAGCTCTCTTTGAAGAAAATCCAGCGGCTCTTCGTATGGCTGTTTGGATTAT
CAGGGAGAGACACACAG
  Box motif
  Complementary to target RNA
length 136
organism Danio_rerio
snoRNA name SNORA30
alias
chromosome ⁄ contig 12.0
locus ⁄ host gene Poly:9:SNORA30
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007123.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved