snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD99
sequence
ACTGATCAAGGATGATAGTATATTGATGGTGACTGCTGGATGAAACTTGCGGATATGGG
ACTGAGATCAGTT
  Box motif
  Complementary to target RNA
length 72
organism Danio_rerio
snoRNA name SNORD99
alias
chromosome ⁄ contig 19.0
locus ⁄ host gene LOC100535315
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007130.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved