snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA3
sequence
AGCGAGACTAGAGTCACATTCTGATGTTGCTTGTTGTCTTTGTGTGCTATAGTACTCGC
AGAATAATCTCTGTACTTATTCATTGGCTGCTGCTTTCCATTGCCCAGCCAATCACCAGC
TCAGAGACATGC
  Box motif
  Complementary to target RNA
length 131
organism Danio_rerio
snoRNA name SNORA3
alias
chromosome ⁄ contig 19.0
locus ⁄ host gene si:ch73-295i22.2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no NC_007130.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved