snOPY snoRNA Orthological Gene Database
Danio_rerio U3
sequence
AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAG
AGTCGAGTCACCCAAACCACGATGAAGAGTGAAGGTGCATTCCTCTGAGCGTGAATCGGA
TAATAATCTGCGGGATAACCATGGATAATTATCATTGATGAACGTTCTGCGATTCTTAAT
GAATCTAAGAGGAGGAGTGCACGAACAGAGTGGT
  Box motif
  Complementary to target RNA
length 213
organism Danio_rerio
snoRNA name U3
alias
chromosome ⁄ contig 7.0
locus ⁄ host gene Mono:18:U3
organization Mono
target RNA 18S rRNA
modification type C/D
modification site
accession no NC_007118.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved