snOPY snoRNA Orthological Gene Database
Danio_rerio snoR38
sequence
TAAAGCCTGTGATGATAGAAGTTATCCCTGTCTGAAAACTGTGTGGACTTCTGGTAACC
TGAGGCTTGC
  Box motif
  Complementary to target RNA
length 69
organism Danio_rerio
snoRNA name snoR38
alias
chromosome ⁄ contig 3.0
locus ⁄ host gene LOC100535890
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NW_003336860.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved