snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD22
sequence
CTTTTATGATGCAACTCGCACACGTCTTACGCCCTGTGTCAATGCCAGAACCTGAAAAG
GTGAACCCACTGGTGTGTCCTGGGCAATAAGGGGATGATCCGTTGGGGTTTCCAACAGTC
TGAGAAGC
  Box motif
  Complementary to target RNA
length 127
organism Danio_rerio
snoRNA name SNORD22
alias
chromosome ⁄ contig 7.0
locus ⁄ host gene wu:fc55g01
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no NC_007118.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved