snOPY snoRNA Orthological Gene Database
Ciona_savignyi snoZ195
sequence
TGTGTCGGTGATGATGATTCAACCACAAACCATCGAATCCTCTACGGAGGTCATGTGAC
CAACCATGCACTACCATCTGAGACACA
  Box motif
  Complementary to target RNA
length 86
organism Ciona_savignyi
snoRNA name snoZ195
alias
chromosome ⁄ contig reftig_247
locus ⁄ host gene ENSCSAVG00000000669
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved