snOPY snoRNA Orthological Gene Database
Ciona_intestinalis SNORD83
sequence
GCCACATGATGCTTTTTTAGATAACACAGTGTTAAACAATGATGACCTTTTATCTATCA
CCCATTTACTGATGGCG
  Box motif
  Complementary to target RNA
length 76
organism Ciona_intestinalis
snoRNA name SNORD83
alias
chromosome ⁄ contig 9q
locus ⁄ host gene Q4H3G6_CIOIN
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved