snOPY snoRNA Orthological Gene Database
Ciona_intestinalis snoZ195
sequence
GTGGCCAATGATGATGAATATATACCCAAATTTTCGAATTTCTTTTAAGAAATTCTGAG
ATAACAACATGCACTACCATCTGAGGCAC
  Box motif
  Complementary to target RNA
length 88
organism Ciona_intestinalis
snoRNA name snoZ195
alias
chromosome ⁄ contig 6q
locus ⁄ host gene ENSCING00000014892
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved