snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA71
sequence
CACAGTATTTGAAAATGATTAGGGCTGCCTGTGCCCTGGGCATTGGTAATGCAGGGAGA
GAAATTGCTAAAAGCCTTTCTCTGTGTTTGGAGGGTTCACTCCCTTCCCTTACAAACTCT
GGAGCTTTTGCACA
  Box motif
  Complementary to target RNA
length 133
organism Cavia_porcellus
snoRNA name SNORA71
alias
chromosome ⁄ contig scaffold_45
locus ⁄ host gene poly:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved