snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD62
sequence
TCTCAGTGACCTGATGCCAGTGGATCCTTCTGACCCCTCAGTGTGGACTTGGCAGCAGG
GCGATGAGGAGGACAGGGAATGGGGAC
  Box motif
  Complementary to target RNA
length 86
organism Cavia_porcellus
snoRNA name SNORD62
alias
chromosome ⁄ contig
locus ⁄ host gene poly: SNORD62
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved