snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD91
sequence
AAGAGGAGTCAATGATGGTTATAACCCACAATGTCTGAACCTATCTGAAGCATCTTTGT
GATGTAGTCATTCTGTCATTCTGAGACTTCTTTAAGA
  Box motif
  Complementary to target RNA
length 96
organism Cavia_porcellus
snoRNA name SNORD91
alias
chromosome ⁄ contig GeneScaffold_5716
locus ⁄ host gene TSR1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved