snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA38
sequence
CCCTCCTACAAAGGCGTGTCCTTTGCTCCCTGTCTTTGGATGCGTAAGAACTGGAGGCA
AAGAAATGAGGATTTGGAGAGATCTCGGGCCGGCTTGCTCCCCGCAGGCTCAAGATCACC
TGTCCCACAATA
  Box motif
  Complementary to target RNA
length 131
organism Cavia_porcellus
snoRNA name SNORA38
alias
chromosome ⁄ contig GeneScaffold_6943
locus ⁄ host gene NUP37
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved