snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD61
sequence
GCTGTGATGAATTTGATTGAATTGATAATCTGACATGATAATGTATTTTTGTCCTCTAA
GAAGTTCTGAGCTT
  Box motif
  Complementary to target RNA
length 73
organism Cavia_porcellus
snoRNA name SNORD61
alias
chromosome ⁄ contig GeneScaffold_4274
locus ⁄ host gene Mono:SNORD61
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved