snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA73
sequence
CCAACGTGGATACCCTGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGA
GCATAGGGCTCTGCCCCATGATGTACAGTCCCTTTCCACAATGTTAGAGAAGAAGCTGGG
CCTTGTGTCTGCGCCTCCATATTCCTACAACTTCTCAGAGTCCTTTGGGCAGTGACTGAG
GAGATAAACCATGCAGAAAACAATA
  Box motif
  Complementary to target RNA
length 204
organism Cavia_porcellus
snoRNA name SNORA73
alias
chromosome ⁄ contig GeneScaffold_7551
locus ⁄ host gene LRIG2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved