snOPY snoRNA Orthological Gene Database
Cavia_porcellus snoZ17
sequence
GGTGCAAATGATGAATCTGTTAGCGACCAAAGCCTGACTTCCTGATTAGTCACAACTGA
CTGACTGCACC
  Box motif
  Complementary to target RNA
length 70
organism Cavia_porcellus
snoRNA name snoZ17
alias
chromosome ⁄ contig GeneScaffold_5697
locus ⁄ host gene RPL23A
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved