snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD63
sequence
GTGCAGTGATGCATTTTATTCAACACATCATTCTCAAAGTACAGAAGTGTGGAAAACTT
AATGACTGAGCACA
  Box motif
  Complementary to target RNA
length 73
organism Cavia_porcellus
snoRNA name SNORD63
alias
chromosome ⁄ contig GeneScaffold_2512
locus ⁄ host gene HSPA9B
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved