snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD29
sequence
TATCAGTGATGACACTAAATAGCTCACTTTTAAAAGGATCTTTTATTTAGTTTTAATGA
AAACTTAACTTGAAATAG
  Box motif
  Complementary to target RNA
length 77
organism Cavia_porcellus
snoRNA name SNORD29
alias
chromosome ⁄ contig GeneScaffold_5503
locus ⁄ host gene ENOX2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved