snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD43
sequence
CACAAATGATGAACTTATTGACGGGCGGACAGAGACTGTGTGCTGATTGTCAAGTTCTG
ATTTG
  Box motif
  Complementary to target RNA
length 64
organism Cavia_porcellus
snoRNA name SNORD43
alias
chromosome ⁄ contig GeneScaffold_1182
locus ⁄ host gene RPL3
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved