snOPY snoRNA Orthological Gene Database
Cavia_porcellus snoU83B
sequence
GCTGTTCCGTGATGAGGCCTTGGAATGCGCGCTGGGCACAGCGCCCGAGTCAGACTGAG
GAACCATTCCCTGTTGCCTTCCTTCTGAGAACAGC
  Box motif
  Complementary to target RNA
length 94
organism Cavia_porcellus
snoRNA name snoU83B
alias
chromosome ⁄ contig GeneScaffold_1182
locus ⁄ host gene RPL3
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved