snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA68
sequence
CTTGCACCTCAACCCAAGAACCGCCACTTCCCGTAGTGACGGTTTAAACAGGGGTGCAC
ATAGTAAGTGGATCTCGTCGCCTTTGGAGGGCTGTGGCTGTGCCCACCAAAGTGAATTTG
GAGGTTCCACACCC
  Box motif
  Complementary to target RNA
length 133
organism Cavia_porcellus
snoRNA name SNORA68
alias
chromosome ⁄ contig scaffold_204852
locus ⁄ host gene ENSCPOG00000015205
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved