snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD83
sequence
GCCAGATGATGTTCGTTGGCTGCAGGAGCACTTGGTGCGAGGACGACTGTTTACCTATC
ACCCATGCCTGATGGCT
  Box motif
  Complementary to target RNA
length 76
organism Cavia_porcellus
snoRNA name SNORD83
alias
chromosome ⁄ contig scaffold_228406
locus ⁄ host gene LOC100723839
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved