snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD50
sequence
AATCAGTGATGAAACCTATCCCGAAGCTGATTACCTGAAGAAAAACATGCACGGATTCG
GCTTCTGAGAT
  Box motif
  Complementary to target RNA
length 70
organism Cavia_porcellus
snoRNA name SNORD50
alias
chromosome ⁄ contig scaffold_237791
locus ⁄ host gene Poly:8:SNORD50
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved