snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD81
sequence
TGGAATACATGATGATCTCACCTCAGCTTGAACCCTCTCCCTGTTTACTGGATGATGAG
CAAAGATCTAATGTTCTA
  Box motif
  Complementary to target RNA
length 77
organism Cavia_porcellus
snoRNA name SNORD81
alias
chromosome ⁄ contig scaffold_54193
locus ⁄ host gene Mono:111:SNORD81
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved