snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD26
sequence
CTGCAGGGATGAGTGAGAACTGAACTCTCTCTTTCTGATGGCTAAATGGAGAAAGCAAA
AGTTCTGAGTAGC
  Box motif
  Complementary to target RNA
length 72
organism Cavia_porcellus
snoRNA name SNORD26
alias
chromosome ⁄ contig GeneScaffold_5751
locus ⁄ host gene Mono:SNORD26
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved