snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA76
sequence
GCGCTGCCTTTGAGCCCCCGTGCGCCTGTGTGTGGCGCCGGGGGTCAAGCTGCGGCGCC
AGAGAAGGTGCTCGCGCATAACTGGGGCCGCCTGCCGTTCGCCGACGGCCCTTTTAACCG
CGAGCTACACGG
  Box motif
  Complementary to target RNA
length 131
organism Cavia_porcellus
snoRNA name SNORA76
alias
chromosome ⁄ contig GeneScaffold_3436
locus ⁄ host gene Poly:23:SNORND104
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved