snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD18
sequence
CCTTGATGATGAGTACCACTTCATGGGACGTGTTTCTGAATTCGATGACATTGCGGACA
ATCTGACCTT
  Box motif
  Complementary to target RNA
length 69
organism Cavia_porcellus
snoRNA name SNORD18
alias
chromosome ⁄ contig GeneScaffold_5844
locus ⁄ host gene Mono:603:SNORD18
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved