snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD105
sequence
GCCCCATCTCTCAGGATGAACCCCACGCCTCTGAGCCTCCATGATTCTGGCTTCAAAGT
AAACGCTCTGAAGAGACGGGCAGAGG
  Box motif
  Complementary to target RNA
length 85
organism Cavia_porcellus
snoRNA name SNORD105
alias
chromosome ⁄ contig scaffold_368
locus ⁄ host gene Mono:SNORD105
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved