snOPY snoRNA Orthological Gene Database
Cavia_porcellus U8
sequence
TCATCAGGTGGGTTAATCTTTACGTTCCTCCTTTTGGAAGGCAGATAGAATATGATTGG
AGTACTGCATGACATGTGATTAATATATTGTGTAATCAGGACTTGCAACACCCTGATTAC
TCCTAATTCTAAT
  Box motif
  Complementary to target RNA
length 132
organism Cavia_porcellus
snoRNA name U8
alias
chromosome ⁄ contig GeneScaffold_526
locus ⁄ host gene Poly:28:SNORA2
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved